Top » Catalog » SNPs » BY6712

$18.00

BY6712
[BY6712]

BY6712
hg38 Position: ChrY:15518684..15518684
Ancestral: T
Derived: C
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b1b1a1b2a4c1a1a~
Comments: Below V22 > L674 > Y16563
Forward Primer: BY6712_F CCATGAGCCTCCTTTTCAAG
Reverse Primer: BY6712_R GTGGTCACCAGGCATTGAG
Reviews

Customers who bought this product also purchased
BY6740
BY6740
M215
M215
Y16563
Y16563
FGC37181
FGC37181
P177
P177
V22
V22
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies