Top » Catalog » SNPs » BY6712

$18.00

BY6712
[BY6712]

BY6712
hg38 Position: ChrY:15518684..15518684
Ancestral: T
Derived: C
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b1b1a1b2a4c1a1a~
Comments: Below V22 > L674 > Y16563
Forward Primer: BY6712_F CCATGAGCCTCCTTTTCAAG
Reverse Primer: BY6712_R GTGGTCACCAGGCATTGAG
Reviews

Customers who bought this product also purchased
V22
V22
FGC37180
FGC37180
E Superclade Panel
E Superclade Panel
V13
V13
FGC37187
FGC37187
L335
L335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies