Top » Catalog » SNPs » FGC37187

$18.00

FGC37187
[FGC37187]

FGC37187
hg38 Position: ChrY:19344995..19344995
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: E1b1b1a1b2a4c1a1c~
Comments: Below V22 > L674 > Y16563
Forward Primer: FGC37187_F TAGTCCTGGCTGGGTAGTGG
Reverse Primer: FGC37187_R CACCACTTGTGACCTTTTGG
Reviews

Customers who bought this product also purchased
L335
L335
BY6697
BY6697
M78
M78
Y16536
Y16536
BY6740
BY6740
M215
M215
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies