Top » Catalog » SNPs » FGC59564

$18.00

FGC59564
[FGC59564]

FGC59564
hg38 Position: ChrY:2851249..2851249
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: R1b
Comments: Below U152 > L2 > DF90
Forward Primer: FGC59564_F CTGGTTATCAGGGACAGAGGG
Reverse Primer: FGC59564_R ACCACTCAGTATACATTCTGCAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies