Top » Catalog » SNPs » FGC59594

$18.00

FGC59594
[FGC59594]

FGC59594
HG19 Position: ChrY:17422703..17422703
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: R1b
Comments: Below U152 > L2 > DF90
Forward Primer: FGC59594_F TGGTGAGGAACTTTGTGCAG
Reverse Primer: FGC59594_R TTGAAGTAGCAGCCCAGGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies