Top » Catalog » SNPs » FGC59600

$18.00

FGC59600
[FGC59600]

FGC59600
HG19 Position: ChrY:21549156..21549156
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: R1b
Comments: Below U152 > L2 > DF90
Forward Primer: FGC59600_F TTCTCCCTCCCTTCTGATTG
Reverse Primer: FGC59600_R ATTTGAGACTGGCGACCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies