Top » Catalog » SNPs » FGC59608

$18.00

FGC59608
[FGC59608]

FGC59608
HG19 Position: ChrY:23614623..23614623
Ancestral: A
Derived: C
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: R1b
Comments: Below U152 > L2 > DF90
Forward Primer: FGC59608_F CAACAATCCCTGCACATACAC
Reverse Primer: FGC59608_R ATTCAGCCTCGTTCCAAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies