Top » Catalog » SNPs » A18341

$18.00

A18341
[A18341]

A18341
hg38 Position: ChrY:12318782..12318782
Ancestral: G
Derived: A
Reference: Andre Viau (2017)
ISOGG Haplogroup: R1b
Comments: Below U152 > L2 > DF90
Forward Primer: A18341_F TAGTGAATGCACAGCCGAAG
Reverse Primer: A18341_R CTGGGTCACAGACTGAAGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies