Top » Catalog » SNPs » A18342

$18.00

A18342
[A18342]

A18342
hg38 Position: ChrY:16524427..16524427
Ancestral: T
Derived: C
Reference: Andre Viau (2017)
ISOGG Haplogroup: R1b
Comments: Below U152 > L2 > DF90
Forward Primer: A18342_F GCAACCAAACTTGTAAATGTCG
Reverse Primer: A18342_R AGAAAAGGCAGGAAGGAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies