Top » Catalog » SNPs » A18342

$18.00

A18342
[A18342]

A18342
HG19 Position: ChrY:18636307..18636307
Ancestral: T
Derived: C
Reference: Andre Viau (2017)
ISOGG Haplogroup: R1b
Comments: Below U152 > L2 > DF90
Forward Primer: A18342_F GCAACCAAACTTGTAAATGTCG
Reverse Primer: A18342_R AGAAAAGGCAGGAAGGAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A14637
$18.00
Haplogroup Info
Other products
Currencies