Top » Catalog » SNPs » A18343

$18.00

A18343
[A18343]

A18343
HG19 Position: ChrY:19542505..19542505
Ancestral: C
Derived: G
Reference: Andre Viau (2017)
ISOGG Haplogroup: R1b
Comments: Below U152 > L2 > DF90
Forward Primer: A18343_F CCTTTGTCATTTTTTATTGGGTCTG
Reverse Primer: A18343_R GACCATCTTCAGGCGTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A14637
$18.00
Haplogroup Info
Other products
Currencies