Top » Catalog » SNPs » A18346

$18.00

A18346
[A18346]

A18346
hg38 Position: ChrY:21186714..21186714
Ancestral: T
Derived: C
Reference: Andre Viau (2017)
ISOGG Haplogroup: R1b
Comments: Below U152 > L2 > DF90
Forward Primer: A18346_F TAGTGGCCCTGTGAAAGGAG
Reverse Primer: A18346_R AAGAAGGGCCTTGCATCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies