Top » Catalog » SNPs » A18347

$18.00

A18347
[A18347]

A18347
HG19 Position: ChrY:23897407..23897407
Ancestral: G
Derived: A
Reference: Andre Viau (2017)
ISOGG Haplogroup: R1b
Comments: Below U152 > L2 > DF90
Forward Primer: A18347_F CAGCCCATCACTCCACTTTC
Reverse Primer: A18347_R CTCAGCTCCCAGTGAAAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A14637
$18.00
Haplogroup Info
Other products
Currencies