Top » Catalog » SNPs » FGC59565

$18.00

FGC59565
[FGC59565]

FGC59565
hg38 Position: ChrY:3011125..3011125
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: R1b
Comments: Below U152 > L2 > DF90
Forward Primer: FGC59565_F CCACAGGAATAGAGAGAAAATGC
Reverse Primer: FGC59565_R TGGCTGCCCAATATATTTTTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies