Top » Catalog » SNPs » FGC59579

$18.00

FGC59579
[FGC59579]

FGC59579
hg38 Position: ChrY:6808984..6808984
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: R1b
Comments: Below U152 > L2 > DF90
Forward Primer: FGC59579_F CAATTTTTCAGGAGCTGTTGC
Reverse Primer: FGC59579_R CCCCGAAGACAGTATTGACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies