Top » Catalog » SNPs » FGC59602

$18.00

FGC59602
[FGC59602]

FGC59602
HG19 Position: ChrY:22088136..22088136
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: R1b
Comments: Below U152 > L2 > DF90
Forward Primer: FGC59602_F AACCTGTGCCAATGAAATCC
Reverse Primer: FGC59602_R TCATCCTGGAGTACCTCGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies