Top » Catalog » SNPs » FGC13794

$18.00

FGC13794
[FGC13794]

FGC13794
hg38 Position: ChrY:16498250..16498250
Ancestral: T
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream CTS3937
Forward Primer: FGC13794_F CAAATGGCTCCTTGTTTATCG
Reverse Primer: FGC13794_R TGCTGAGTGGCCAAAATATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies