Top » Catalog » SNPs » FGC67646

$18.00

FGC67646
[FGC67646]

FGC67646
hg38 Position: ChrY:14755285..14755285
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1i
Comments: Below S1051
Forward Primer: FGC67646_F TGACGTGCTTATCAATTTTAGTGG
Reverse Primer: FGC67646_R CAGGTGTGAGACTCTGTTCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies