Top » Catalog » SNPs » FGC67649

$18.00

FGC67649
[FGC67649]

FGC67649
HG19 Position: ChrY:18683947..18683947
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1i
Comments: Below S1051
Forward Primer: FGC67649_F TGCAGGAGGATCAAAGTGTG
Reverse Primer: FGC67649_R CAGGTGGCCTTTAAAAGTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies