Top » Catalog » SNPs » Z113

$18.00

Z113
[Z113]

Z113
hg38 Position: ChrY:15057758..15057758
Ancestral: C
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: I2
Comments: downstream of I-L160
Forward Primer: Z113_F ACACATACAAGGGGCAATGG
Reverse Primer: Z113_R TCCCTGCCTCCCAAGTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies