Top » Catalog » SNPs » A18354

$18.00

A18354
[A18354]

A18354
HG19 Position: ChrY:6536879..6536879
Ancestral: T
Derived: G
Reference: YSEQ (2017)
ISOGG Haplogroup: I1
Comments: Downstream S2293 > S6277 > Y15902 > Y15575 > Y16450 > Y16452
Forward Primer: A18354_F CCGACCTATTTATAACATTTATGGG
Reverse Primer: A18354_R GGCATTTGATGACACCCATG
Reviews

Customers who bought this product also purchased
A18355
A18355
DYS390
DYS390
YSEQ-Alpha
YSEQ-Alpha
A18358
A18358
DNA Sample Kit
DNA Sample Kit
A18357
A18357
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies