Top » Catalog » SNPs » A18355

$18.00

A18355
[A18355]

A18355
hg38 Position: ChrY:7134503..7134503
Ancestral: C
Derived: G
Reference: YSEQ (2017)
ISOGG Haplogroup: I1
Comments: Downstream S2293 > S6277 > Y15902 > Y15575 > Y16450 > Y16452
Forward Primer: A18355_F CTCTCTGGCAGTCCTTAACATG
Reverse Primer: A18355_R TCCCTGGCCCCGTGTG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
A18357
A18357
Whole Genome Sequence
Whole Genome Sequence
A18356
A18356
A18354
A18354
DYS390
DYS390
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies