Top » Catalog » SNPs » A18356

$18.00

A18356
[A18356]

A18356
hg38 Position: ChrY:12062517..12062517
Ancestral: A
Derived: G
Reference: YSEQ (2017)
ISOGG Haplogroup: I1
Comments: Downstream S2293 > S6277 > Y15902 > Y15575 > Y16450 > Y16452
Forward Primer: A18356_F AATGAGATACTATGTCACACCAATTAGG
Reverse Primer: A18356_R GTTCAAGTGTTCTCATTGTTCGA
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
A18357
A18357
Whole Genome Sequence
Whole Genome Sequence
A18355
A18355
A18354
A18354
DYS390
DYS390
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies