Top » Catalog » SNPs » A18356

$18.00

A18356
[A18356]

A18356
hg38 Position: ChrY:12062517..12062517
Ancestral: A
Derived: G
Reference: YSEQ (2017)
ISOGG Haplogroup: I1
Comments: Downstream S2293 > S6277 > Y15902 > Y15575 > Y16450 > Y16452
Forward Primer: A18356_F AATGAGATACTATGTCACACCAATTAGG
Reverse Primer: A18356_R GTTCAAGTGTTCTCATTGTTCGA
Reviews

Customers who bought this product also purchased
A18357
A18357
Whole Genome Sequence
Whole Genome Sequence
A18355
A18355
A18354
A18354
DYS390
DYS390
YSEQ-Alpha
YSEQ-Alpha
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies