Top » Catalog » SNPs » A18357

$18.00

A18357
[A18357]

A18357
hg38 Position: ChrY:19085537..19085537
Ancestral: G
Derived: A
Reference: YSEQ (2017)
ISOGG Haplogroup: I1
Comments: Downstream S2293 > S6277 > Y15902 > Y15575 > Y16450 > Y16452
Forward Primer: A18357_F CTGTGGCATACCTGAGTGAGA
Reverse Primer: A18357_R ATTGCGTACCCCACATTTCA
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
A18358
A18358
DNA Sample Kit
DNA Sample Kit
A18356
A18356
Whole Genome Sequence
Whole Genome Sequence
A18355
A18355
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies