Top » Catalog » SNPs » A18357

$18.00

A18357
[A18357]

A18357
HG19 Position: ChrY:19085537..19085537
Ancestral: G
Derived: A
Reference: YSEQ (2017)
ISOGG Haplogroup: I1
Comments: Downstream S2293 > S6277 > Y15902 > Y15575 > Y16450 > Y16452
Forward Primer: A18357_F CTGTGGCATACCTGAGTGAGA
Reverse Primer: A18357_R ATTGCGTACCCCACATTTCA
Reviews

Customers who bought this product also purchased
A18356
A18356
Whole Genome Sequence
Whole Genome Sequence
A18355
A18355
A18354
A18354
DYS390
DYS390
YSEQ-Alpha
YSEQ-Alpha
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies