Top » Catalog » SNPs » A18358

$18.00

A18358
[A18358]

A18358
HG19 Position: ChrY:20620620..20620620
Ancestral: G
Derived: T
Reference: YSEQ (2017)
ISOGG Haplogroup: I1
Comments: Downstream S2293 > S6277 > Y15902 > Y15575 > Y16450 > Y16452
Forward Primer: A18358_F ACTTGAGGAGGCAGACTGTCTG
Reverse Primer: A18358_R GGCCTTTTAAATCAGCTTTGATG
Reviews

Customers who bought this product also purchased
A18354
A18354
DYS390
DYS390
YSEQ-Alpha
YSEQ-Alpha
A18357
A18357
DNA Sample Kit
DNA Sample Kit
A18356
A18356
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies