Top » Catalog » SNPs » A18358

$18.00

A18358
[A18358]

A18358
hg38 Position: ChrY:20620620..20620620
Ancestral: G
Derived: T
Reference: YSEQ (2017)
ISOGG Haplogroup: I1
Comments: Downstream S2293 > S6277 > Y15902 > Y15575 > Y16450 > Y16452
Forward Primer: A18358_F ACTTGAGGAGGCAGACTGTCTG
Reverse Primer: A18358_R GGCCTTTTAAATCAGCTTTGATG
Reviews

Customers who bought this product also purchased
DYS390
DYS390
YSEQ-Alpha
YSEQ-Alpha
A18357
A18357
DNA Sample Kit
DNA Sample Kit
A18356
A18356
Whole Genome Sequence
Whole Genome Sequence
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies