Top » Catalog » SNPs » Y35620

$18.00

Y35620
[Y35620]

Y35620
hg38 Position: ChrY:15637661..15637661
Ancestral: C
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: Y35620_F AGACAGGTCATCCTGCCTTC
Reverse Primer: Y35620_R TAGGCACTGATGAGCACAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies