Top » Catalog » SNPs » Y35621

$18.00

Y35621
[Y35621]

Y35621
HG19 Position: ChrY:16479528..16479528
Ancestral: A
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: Y35621_F CAGGAGCACTCCTATTTTTGC
Reverse Primer: Y35621_R TGGCTCATTTTGGGGAATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies