Top » Catalog » SNPs » Y33200

$18.00

Y33200
[Y33200]

Y33200
hg38 Position: ChrY:7390534..7390534
Ancestral: C
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: Below A1777 > CTS883
Forward Primer: Y33200v2_F TCCTGACTCTGGCACATCAC
Reverse Primer: Y33200v2_R TCTGCCTCCTGGGTTCAAC
Reviews

Customers who bought this product also purchased
BY63033
BY63033
FT49932
FT49932
Z282
Z282
A366
A366
R1a Superclade Panel
R1a Superclade Panel
CTS9416
CTS9416
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies