Top » Catalog » SNPs » Y33200

$18.00

Y33200
[Y33200]

Y33200
hg38 Position: ChrY:7390534..7390534
Ancestral: C
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: Below A1777 > CTS883
Forward Primer: Y33200_F CATCACCCCATGACAGACAG
Reverse Primer: Y33200_R TCAGCTCACTGCAACCTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies