Top » Catalog » SNPs » FGC67635

$18.00

FGC67635
[FGC67635]

FGC67635
hg38 Position: ChrY:15474515..15474515
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC67635_F AAATGGCCAAGCAAATGATG
Reverse Primer: FGC67635_R CCCACCCTCAATCAACAAAG
Reviews

Customers who bought this product also purchased
FGC67636
FGC67636
FGC67634
FGC67634
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies