Top » Catalog » SNPs » FGC67636

$18.00

FGC67636
[FGC67636]

FGC67636
hg38 Position: ChrY:17080050..17080050
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC67636_F CAGCAAAGGGAAGAAACAGG
Reverse Primer: FGC67636_R CCTTAAGCAGGCCACACTTC
Reviews

Customers who bought this product also purchased
FGC67634
FGC67634
FGC67635
FGC67635
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies