Top » Catalog » SNPs » Z39334

$18.00

Z39334
[Z39334]

Z39334
HG19 Position: ChrY:12966954..12966954
Ancestral: C
Derived: T
Reference: ISOGG index (2017)
ISOGG Haplogroup: G
Comments: .
Forward Primer: Z39334_F ATTGTCTCTCCCTGGTGCTG
Reverse Primer: Z39334_R GCTCTGGCATTAAGCTGGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies