Top » Catalog » SNPs » F25958

$18.00

F25958
[F25958]

F25958
hg38 Position: ChrY:21161856..21161856
Ancestral: C
Derived: T
Reference: Ryan Lan-Hai Wei (2017)
ISOGG Haplogroup: unknown
Comments: Below L233 and A8462
Forward Primer: F25958_F GGCTGTCCTCTGCTAAATGG
Reverse Primer: F25958_R TGAGTTCCCCCAATAAAGGTC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Prepaid Return Envelope
Prepaid Return Envelope
A16520
A16520
CTS595
CTS595
A8462
A8462
I2a-CTS595 Panel
I2a-CTS595 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC30566
$18.00
Haplogroup Info
Other products
Currencies