Top » Catalog » SNPs » F25958

$18.00

F25958
[F25958]

F25958
hg38 Position: ChrY:21161856..21161856
Ancestral: C
Derived: T
Reference: Ryan Lan-Hai Wei (2017)
ISOGG Haplogroup: unknown
Comments: Below L233 and A8462
Forward Primer: F25958_F GGCTGTCCTCTGCTAAATGG
Reverse Primer: F25958_R TGAGTTCCCCCAATAAAGGTC
Reviews

Customers who bought this product also purchased
Prepaid Return Envelope
Prepaid Return Envelope
DNA Sample Kit
DNA Sample Kit
Y4252
Y4252
L160
L160
A14893
A14893
M26
M26
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies