Top » Catalog » SNPs » FGC4294

$18.00

FGC4294
[FGC4294]

FGC4294
hg38 Position: ChrY:16950696..16950696
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4294_F CCAGCAAGCTCCAGTAGACC
Reverse Primer: FGC4294_R GCTTCCTTGCATTGGGTTAG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
FGC10424
FGC10424
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies