Top » Catalog » SNPs » A18466

$18.00

A18466
[A18466]

A18466
HG19 Position: ChrY:12165150..12165150
Ancestral: C
Derived: A
Reference: Alex Buchanan
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A18466_F TGCACCACTGCACTCTATCC
Reverse Primer: A18466_R TCCCAAAATGCTGGGATTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies