Top » Catalog » SNPs » F4134

$18.00

F4134
[F4134]

F4134
hg38 Position: ChrY:9296115..9296115
Ancestral: G
Derived: A
Reference: Yan Shi (2011)
ISOGG Haplogroup: not listed
Comments: Found in a hg O3 person, downstream of F862. Observed in N1c as well.
Forward Primer: F4134_F TGTGCCACCCTCCGATAG
Reverse Primer: F4134_R CAGCAATAAGGTCTGATAGGGAAAG
Reviews

Customers who bought this product also purchased
CTS10760
CTS10760
Y28526
Y28526
N1c-CTS10760 Panel
N1c-CTS10760 Panel
A17886
A17886
Y32731
Y32731
Y28536
Y28536
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies