Top » Catalog » SNPs » F4134

$18.00

F4134
[F4134]

F4134
hg38 Position: ChrY:9296115..9296115
Ancestral: G
Derived: A
Reference: Yan Shi (2011)
ISOGG Haplogroup: not listed
Comments: Found in a hg O3 person, downstream of F862. Observed in N1c as well.
Forward Primer: F4134_F TGTGCCACCCTCCGATAG
Reverse Primer: F4134_R CAGCAATAAGGTCTGATAGGGAAAG
Reviews

Customers who bought this product also purchased
A17886
A17886
Y32731
Y32731
Y28536
Y28536
PH1266
PH1266
CTS10760
CTS10760
Y28526
Y28526
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies