Top » Catalog » SNPs » BY19910

$18.00

BY19910
[BY19910]

BY19910
hg38 Position: ChrY:17179191..17179191
Ancestral: C
Derived: G
Reference: FTDNA (2017)
ISOGG Haplogroup: I2
Comments: Below Y4752 > YP6208
Forward Primer: BY19910_F CTTGAGCCCAGGAACTTGAG
Reverse Primer: BY19910_R TTGAAATGGACCGCTTACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies