Top » Catalog » SNPs » A18558

$18.00

A18558
[A18558]

A18558
hg38 Position: ChrY:6831695..6831695
Ancestral: C
Derived: T
Reference: Colin Ferguson (2017)
ISOGG Haplogroup: I2
Comments: Below Y4752 > YP6208
Forward Primer: A18558_F GCCTCCCTTCTTTCATAACTTTTTT
Reverse Primer: A18558_R CTGGATGCAAAGTTGTAGGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies