Top » Catalog » SNPs » Z17582

$18.00

Z17582
[Z17582]

Z17582
hg38 Position: ChrY:17331213..17331213
Ancestral: C
Derived: G
Reference: Y DNA community
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of DF41. approx. L746
Forward Primer: Z17582_F TTTCCAGGACAGCATCAGAAG
Reverse Primer: Z17582_R CAGTGGATTTGTGAGTAAGGTATCAG
Reviews

Customers who bought this product also purchased
S775
S775
A749
A749
DF41
DF41
Y14197
Y14197
S781
S781
Z17581
Z17581
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies