Top » Catalog » SNPs » Z17582

$18.00

Z17582
[Z17582]

Z17582
hg38 Position: ChrY:17331213..17331213
Ancestral: C
Derived: G
Reference: Y DNA community
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of DF41. approx. L746
Forward Primer: Z17582_F TTTCCAGGACAGCATCAGAAG
Reverse Primer: Z17582_R CAGTGGATTTGTGAGTAAGGTATCAG
Reviews

Customers who bought this product also purchased
Z17581
Z17581
R1b-DF41 Panel (including Royal Stewart clades)
R1b-DF41 Panel (including Royal Stewart clades)
L746
L746
A40
A40
Y14198
Y14198
S775
S775
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies