Top » Catalog » SNPs » BY10374

$18.00

BY10374
[BY10374]

BY10374
hg38 Position: ChrY:21190872..21190872
Ancestral: T
Derived: C
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b1b1a1b2a4c1a1a1a1a1~
Comments: Below BY10375
Forward Primer: BY10374_F TGAGTTACCAAATTCTTTCTTCAGC
Reverse Primer: BY10374_R CTTTCCCAGAAAAGCCAGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies