Top » Catalog » SNPs » BY4914

$18.00

BY4914
[BY4914]

BY4914
hg38 Position: ChrY:14254618..14254618
Ancestral: C
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b1b1a1b1a10b (not listed)
Comments: Below FGC11457
Forward Primer: BY4914_F GGCATGAACCCAGGAGATG
Reverse Primer: BY4914_R GTCTATCTGGGCCATTTTGC
Reviews

Customers who bought this product also purchased
Z16659
Z16659
A9479
A9479
S2979
S2979
FGC11451
FGC11451
M35.2
M35.2
FGC11450
FGC11450
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies