Top » Catalog » SNPs » Z17615

$18.00

Z17615
[Z17615]

Z17615
hg38 Position: ChrY:8478994..8478994
Ancestral: G
Derived: A
Reference: Y DNA community
ISOGG Haplogroup: R1b (not listed)
Comments: downstream of L1335 > L1065 > PF5236
Forward Primer: Z17615_F TGGCATAAGCTGTTTTCATCC
Reverse Primer: Z17615_R TTCATTACCCAGCAACCTGAC
Reviews

Customers who bought this product also purchased
FGC1707
FGC1707
ZS12078
ZS12078
FGC4441
FGC4441
ZS10555
ZS10555
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC36738
FGC36738
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies