Top » Catalog » SNPs » Z814

$18.00

Z814
[Z814]

Z814
hg38 Position: ChrY:11916015..11916018
Ancestral: ins
Derived: del
Reference: Ray Banks (2011)
ISOGG Haplogroup: E1b1b1a1a1b
Comments: Downstream from V12 > Y15945, above Z809 & Y17859.
Forward Primer: Z814_F GAGTGGTTCTGGACCCCAAC
Reverse Primer: Z814_R TGAAGACCAGGGGGGAAG
Reviews

Customers who bought this product also purchased
CTS693
CTS693
BY8141
BY8141
E1b-V12 Panel
E1b-V12 Panel
Y15945
Y15945
V22
V22
Y28701
Y28701
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies