Top » Catalog » SNPs » BY246

$18.00

BY246
[BY246]

BY246
hg38 Position: ChrY:6969316..6969316
Ancestral: C
Derived: A
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c~
Comments: Found in a person of the McWho cluster
Forward Primer: BY246_F CGAAAAAGGAAGCAACTGTG
Reverse Primer: BY246_R ATGGTCACCCACCATTTTTC
Reviews

Customers who bought this product also purchased
BY2687
BY2687
BY2723
BY2723
A5383
A5383
A5381
A5381
BY2693
BY2693
R1b-MC14_BY246 Panel
R1b-MC14_BY246 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies