Top » Catalog » SNPs » BY246

$18.00

BY246
[BY246]

BY246
hg38 Position: ChrY:6969316..6969316
Ancestral: C
Derived: A
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c~
Comments: Found in a person of the McWho cluster
Forward Primer: BY246_F CGAAAAAGGAAGCAACTGTG
Reverse Primer: BY246_R ATGGTCACCCACCATTTTTC
Reviews

Customers who bought this product also purchased
FGC5494
FGC5494
M343
M343
A2070
A2070
DF21
DF21
FGC11134
FGC11134
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies