Top » Catalog » SNPs » BY246

$18.00

BY246
[BY246]

BY246
hg38 Position: ChrY:6969316..6969316
Ancestral: C
Derived: A
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c~
Comments: Found in a person of the McWho cluster
Forward Primer: BY246_F CGAAAAAGGAAGCAACTGTG
Reverse Primer: BY246_R ATGGTCACCCACCATTTTTC
Reviews

Customers who bought this product also purchased
DF13
DF13
CTS3386
CTS3386
L21
L21
A7298
A7298
Z253
Z253
FGC5494
FGC5494
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies