Top » Catalog » SNPs » PF7445

$18.00

PF7445
[PF7445]

PF7445
hg38 Position: ChrY:14442865..14442865
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: T1a1a1a1b1
Comments: Extracted from genome study of Sardinian samples; below Y28684
Forward Primer: PF7445_F TCTGTAAATCTTTCTAGGGATCAGAG
Reverse Primer: PF7445_R CAGAATATTGTAGCCTCTAACTGTATGAG
Reviews

Customers who bought this product also purchased
CTS11451
CTS11451
Y12641
Y12641
T Superclade Panel
T Superclade Panel
Y12643
Y12643
FGC3995
FGC3995
Y15127
Y15127
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies