Top » Catalog » SNPs » PF7445

$18.00

PF7445
[PF7445]

PF7445
hg38 Position: ChrY:14442865..14442865
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: T1a1a1a1b1
Comments: Extracted from genome study of Sardinian samples; below Y28684
Forward Primer: PF7445_F TCTGTAAATCTTTCTAGGGATCAGAG
Reverse Primer: PF7445_R CAGAATATTGTAGCCTCTAACTGTATGAG
Reviews

Customers who bought this product also purchased
BY11471
BY11471
PF7443
PF7443
Y22559
Y22559
PF7444
PF7444
Y6671
Y6671
BY28361
BY28361
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies